Order smallest to largest.

organ, cell, tissue, body system

Answers

Answer 1
Answer:

Answer:

Explanation:

cells, tissues, organ, and body system.

Answer 2
Answer: cell, tissue, organ, body system

Related Questions

Which of the following is the semi-fluid transition zone of the mantle between the lithosphere and the mesosphere?AsthenosphereAtmosphereBiosphereGeosphere
Match up macromolecules with example.a. carbohydrates __cholesterol or fatb. proteins __dna or rnac. lipids __hemoglobin or enzymed. nucleic acids __glycogen or starch
Can u help me please
What type of intelligence refers to a person's ability to reason speedily and abstractly? a. Fluid intelligence b. Mechanical intelligence c. Crystallized intelligence Pragmatic intelligence
A variety of factors influence enzyme activity. Substances that bind to the enzyme and interfere with substrate binding or catalysis are inhibitors. Identify the type of inhibition associated with each of the descriptions and examples by classifying each statement as irreversible, competitive, or mixed inhibition.

!!!!HELP!!!! BEST ANSWER GETS BRAINLIEST!!!!!The phases of the moon are caused by

A)
the moon revolving around the sun and Earth.


B)
Earth revolving around the sun and the sun's light being reflect off the moon.


C)
the moon revolving around Earth and the moon reflecting sunlight towards Earth.


D)
the moon revolving around Earth with sunlight reflecting off of Earth towards the moon.

Answers

B) Earth revolving around the sun and the sun's light being reflected off the moon because the moon orbits earth and earth orbits the sun so the sun lights the moon

        Signed by, Virtuoso Sargedog

If a star is 300 light-years from Earth, how long does it take light from that star to reach Earth? 300 light-years 300 years 300 hours 300 days

Answers

If a star is 300 light-years from Earth, it will take 300 light years from that star to reach Earth. So, the correct option is A.

What is Light year?

A light year is defined as the larger unit of length used to express astronomical distances which is approximately equal to 9.46 trillion kilometers or 5.88 trillion miles.

A light year is explained as a measure of distance and not as time where light travels at a speed of 300,000 km/s where the distance that light will travel in one year is considered as a light year which is 9.4611012 is equal to km. When a star is 300 light-years from Earth, it will take 300 light years from that star to reach Earth.

Therefore, the correct option is A.

Learn more about Light years, here:

brainly.com/question/1302132

#SPJ6

Your question is incomplete, most probably the complete question is:

If a star is 300 light years away from Earth, how long does it take light from that star to reach Earth?

A. 300 light-years

B. 300 years

C. 300 hours

D. 300 days

It would take 300 light years to reach Earth.

An example of a process in which entropy decreases is _____.Select one:
a. vaporization
b. freezing
c. boiling
d. melting

Answers

B. When it is freezing.
the anwser is A because it decreases the process each time something vaporization

According to the graph shown above, what temperature results in the highest level of enzyme activity?PLZ HELP ASAP

Answers

Correct answer is C. It's really simple.

Hey I need Someone to help me quickly

Answers

The answer would be A

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'